|
New England Biolabs
t3 rna polymerase T3 Rna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/t3+rna+polymerase/pm41587814-358-7-10?v=New+England+Biolabs Average 96 stars, based on 1 article reviews
t3 rna polymerase - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
New England Biolabs
t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments T3 5ʹaattaaccctcactaaaggg 3ʹ Promoter Tagged Pcr Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/t3+rna+polymerase/pm41823500-59-17-25?v=New+England+Biolabs Average 98 stars, based on 1 article reviews
t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments - by Bioz Stars,
2026-08
98/100 stars
|
Buy from Supplier |
|
New England Biolabs
t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments T3 5ʹ Aattaaccctcactaaaggg 3ʹ Promoter Tagged Pcr Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/t3+rna+polymerase/pmc13001824-34-17-25?v=New+England+Biolabs Average 98 stars, based on 1 article reviews
t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments - by Bioz Stars,
2026-08
98/100 stars
|
Buy from Supplier |
|
New England Biolabs
t3 rnap promoter T3 Rnap Promoter, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/t3+rna+polymerase/us12545907-118-30-73?v=New+England+Biolabs Average 96 stars, based on 1 article reviews
t3 rnap promoter - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
New England Biolabs
t3 rnap T3 Rnap, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/t3+rna+polymerase/us12545907-118-27-73?v=New+England+Biolabs Average 96 stars, based on 1 article reviews
t3 rnap - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |