Review





Similar Products

96
New England Biolabs t3 rna polymerase
T3 Rna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t3+rna+polymerase/pm41587814-358-7-10?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
t3 rna polymerase - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

98
New England Biolabs t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments
T3 5ʹaattaaccctcactaaaggg 3ʹ Promoter Tagged Pcr Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t3+rna+polymerase/pm41823500-59-17-25?v=New+England+Biolabs
Average 98 stars, based on 1 article reviews
t3 5ʹaattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments - by Bioz Stars, 2026-08
98/100 stars
  Buy from Supplier

98
New England Biolabs t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments
T3 5ʹ Aattaaccctcactaaaggg 3ʹ Promoter Tagged Pcr Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t3+rna+polymerase/pmc13001824-34-17-25?v=New+England+Biolabs
Average 98 stars, based on 1 article reviews
t3 5ʹ aattaaccctcactaaaggg 3ʹ promoter tagged pcr fragments - by Bioz Stars, 2026-08
98/100 stars
  Buy from Supplier

96
New England Biolabs t3 rnap promoter
T3 Rnap Promoter, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t3+rna+polymerase/us12545907-118-30-73?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
t3 rnap promoter - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
New England Biolabs t3 rnap
T3 Rnap, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t3+rna+polymerase/us12545907-118-27-73?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
t3 rnap - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

Image Search Results